α-Mangostin and Apigenin Induced Cell Cycle Arrest and Programmed Cell Death in SKOV-3 Ovarian Cancer Cells
Toxicological Research 2019;35:167−179
Published online April 30, 2019;  https://doi.org/10.5487/TR.2019.35.2.167
© 2019 Korean Society of Toxicology.

Teeranai Ittiudomrak1, Songchan Puthong2, Sittiruk Roytrakul3, and Chanpen Chanchao4

1Program in Biotechnology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand, 2Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Bangkok, Thailand, 3National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Pathum Thani, Thailand, 4Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand
Chanpen Chanchao, Department of Biology, Faculty of Science, Chulalongkorn University, 254 Phayathai Road, Bangkok 10330, Thailand, E-mail: chanpen.c@chula.ac.th
Received: July 16, 2018; Revised: September 7, 2018; Accepted: October 4, 2018
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Ovarian cancer is the fifth main cause of pre-senescent death in women. Although chemotherapy is generally an efficient treatment, its side effects and the occurrence of chemotherapeutic resistance have prompted the need for alternative treatments. In this study, α-mangostin and apigenin were evaluated as possible anticancer alternatives to the chemotherapeutic drug doxorubicin, used herein as a positive control. The ovarian adenocarcinoma cell line SKOV-3 (ATCC No. HTB77) was used as model ovarian cancer cells, whereas the skin fibroblast line CCD-986Sk (ATCC No. CRL-1947) and lung fibroblast line WI-38 (ATCC No. CCL-75) were used as model untransformed cells. Apigenin and doxorubicin inhibited the growth of SKOV-3 cells in a dose- and time-dependent manner. After 72 hr exposure, doxorubicin was mostly toxic to SKOV-3 cells, whereas apigenin was toxic to SKOV-3 cells but not CCD-986Sk and WI-38 cells. α-Mangostin was more toxic to SKOV-3 cells than to CCD-986Sk cells. A lower cell density, cell shrinkage, and more unattached (floating round) cells were observed in all treated SKOV-3 cells, but the greatest effects were observed with α-mangostin. With regard to programmed cell death, apigenin caused early apoptosis within 24 hr, whereas α-mangostin and doxorubicin caused late apoptosis and necrosis after 72 hr of exposure. Caspase-3 activity was significantly increased in α-mangostin-treated SKOV-3 cells after 12 hr of exposure, whereas only caspase-9 activity was significantly increased in apigenin-treated SKOV-3 cells at 24 hr. Both α-mangostin and apigenin arrested the cell cycle at the G2/M phase, but after 24 and 48 hr, respectively. Significant upregulation of BCL2 (apoptosis-associated gene) and COX2 (inflammation-associated gene) transcripts was observed in apigenin- and α-mangostin-treated SKOV-3 cells, respectively. α-Mangostin and apigenin are therefore alternative options for SKOV-3 cell inhibition, with apigenin causing rapid early apoptosis related to the intrinsic apoptotic pathway, and α-mangostin likely being involved with inflammation.

Keywords : α-Mangostin, Apigenin, Apoptosis, Caspase activity, Cell cycle arrest, Ovarian cancer
INTRODUCTION

Ovarian cancer is the fifth main cause of pre-senescent (unnatural) death in women (1) and the most common cause of gynecological cancer-associated deaths (2). Among cervical, ovarian, and uterine cancers, ovarian cancer has reportedly caused the highest rate of deaths (3). Ovarian cancer, like other solid tumors, is associated with the deterioration of the intracellular structure, change in cellular adhesion, cell migration, invasion, proliferation, and angiogenesis (4). It is a major problem for public health globally owing to its undefined signs and symptoms, making it essentially asymptomatic until at an advanced stage and thus preventing its early diagnosis and treatment. For decades, surgery and chemotherapy, especially platinumor taxol-based chemotherapy as well as the more recent monoclonal antibody-directed bevacizumab, have been introduced for ovarian cancer treatment, but these procedures are not fully effective because of their adverse side effects and the advent of chemoresistance (5). Hence, novel or alternative treatments are necessary for the treatment of patients with ovarian cancer.

Natural products, especially herbs, have gained increasing attention for use in ovarian cancer therapy to inhibit the proliferation and induce apoptosis of the cancer cells, with the potential benefits of less side effects and reduced resistance (for now) (6). Thus, many natural compounds or chemicals have been isolated, mainly from plants (e.g., cryptotanshinone in the traditional Chinese herbal medicine Salvia miltiorrhiza Bge. (7)), and the molecular mechanisms of action of some of these compounds have been reported. For example, proanthocyanidins from the leaves of Chinese bayberry (Myrica rubra Sieb. et Zucc.) showed strong inhibitory effects against cell growth (with cell cycle arrest at the G1 phase), angiogenesis, and the migration and invasion of A2780/CP70 cisplatin-resistant ovarian cancer cells (8). In addition to natural compounds, synthetic compounds have been reported to be promising therapeutic sources. For example, synthesized (1E,4E)-6-(1-(isopentyloxy)nonyl)-5-methoxynaphthalene-1,4-dione dioxime, which is a derivative of 1,4-naphthoquinone oxime, was reported to be strongly toxic to the ovarian cancer cell line A2780, with a half maximal inhibitory concentration (IC50) value of 8.26 ± 0.22 μM (9). Furthermore, O2-(acetoxymethyl)-1-(iso-butylamino)diazen-1-ium-1,2-diolate and O2-(acetoxymethyl)-1-(isopropylamino)diazen-1-ium-1,2-diolate, synthesized from primary amine-based diazeniumdiolates, reduced the proliferation of SKOV-3 and ES2 ovarian cancer cells at 0.033–1.0 mg/mL after 24 hr of exposure (10).

In this study, α-mangostin and apigenin were focused on as possible therapeutic agents because both can be isolated from many natural products in Thailand. α-Mangostin is mainly isolated from the pericarp of Garcinia mangostana (11) and the cerumen of the stingless bee Tetragonula laeviceps (12), whereas apigenin is the main compound extracted from Roman chamomile (Chamaemelum nobile (L.)) (13) and bee pollen (Apis mellifera) (14). Both compounds have been reported to have many bioactivities, including anti-biofilm formation (15), anti-aging (16), anti-inflammatory (17), and anti-gout (18) activities. Furthermore, only a few studies have been reported on the contribution of both compounds to SKOV-3 ovarian cancer prevention. Considering only gynecological cancers, α-mangostin has been reported to inhibit the growth of HeLa human cervical cancer cells (19), but there are no reports on its effect on the SKOV-3 ovarian cancer cell line. For apigenin, only a few studies on its effect on the SKOV3 cancer cell line are available (20,21). Thus, more data on these two natural compounds are necessary.

The aim of this present study was to evaluate the in vitro toxicity of α-mangostin and apigenin in SKOV-3 ovarian cancer cells in comparison with that in the untransformed CCD-986Sk skin fibroblast and WI-38 lung fibroblast lines as model normal human cells, using the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Changes in the morphology of the treated cells were observed by light microscopy. Programmed cell death was investigated by flow cytometry following annexin V-Alexa Fluor 488 and propidium iodide (PI) staining, whereas cell cycle arrest was likewise investigated after PI staining only. The activities of caspase-3, -8, and -9 were also evaluated, and changes in the transcript expression levels of representative inflammation-associated genes, proto-oncogenes, autophagy-associated genes, and apoptosis-associated genes were investigated by the quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR). Overall, the data obtained provide a broader insight into how α-mangostin and apigenin inhibit the growth of SKOV-3 ovarian cancer cells.

MATERIALS AND METHODS

Cell culture

The human ovarian adenocarcinoma-derived cell line SKOV-3 (ATCC No. HTB77) was cultured in McCoy’s 5A (modified) medium supplemented with 10% (v/v) fetal calf serum (FCS). The untransformed (normal) human skin fibroblast line CCD-986Sk (ATCC No. CRL-1947) and lung fibroblast line WI-38 (ATCC No. CCL-75) were used for direct comparison with SKOV-3. Both CCD-986Sk and WI-38 cells were cultured in Eagle’s Minimum Essential Medium (MEM) supplemented with 10% (v/v) FCS. All three cell lines were cultured and tested at 37°C with 5% (v/v) CO2 in a humidified environment.

MTT assay of cell viability and proliferation

CCD-986Sk and WI-38 cells were seeded at 1 × 104 cells/well in 96-well plates containing 200 μL of medium for overnight culture, whereas SKOV-3 cells were cultured in the same manner but seeded at 5 × 103 cells/well. Then, the cells were treated with various concentrations of apigenin, α-mangostin, or doxorubicin, or the 0.1% (v/v) dimethyl sulfoxide (DMSO) solvent only (control). The SKOV-3 cells were treated for 24, 48, and 72 hr, whereas the CCD-986Sk and WI-38 cells were treated for 24 hr only. After the indicated incubation (exposure) time was reached, 10 μL of 5 mg/mL MTT solution was added to each well and the culture plates were incubated for 3 hr to allow for mazan formation. The culture medium was then removed, the formazan was solubilized by the addition of 150 μL of DMSO, and the absorbance at 560 nm (A560) was measured with a microplate reader. The cell viability (%) was calculated using Eq. (1) as follows:

Cell viability (%)=100×(A560treated cells-A560blank)/(A560untreated cells-A560blank)

The IC50 value of each compound was calculated from the graphical plot of the relative number of viable cells (%) vs. the test compound concentration.

Cell imaging

Test cells at 5 × 105 cells in 5 mL of medium in a 25-cm2 flask were cultured overnight and treated the next day with 0.1% (v/v) DMSO alone (control) or DMSO containing α-mangostin (7.309 μM), apigenin (18.502 μM), or doxorubicin (0.431 μM) for 24, 48, and 72 hr. Live cell images were captured using a Nikon Eclipse TS100 microscope coupled with a DS-L3 imaging system at 40×, 100×, and 200× magnifications.

Apoptosis and cell cycle analysis

The test cells were cultured as described in the Cell imaging section above and harvested at the indicated times by trypsinization with 0.05% (w/v) trypsin in 0.5 mM ethylenediaminetetraacetic acid buffer. The cells were then washed twice with cold phosphate-buffered saline (PBS), using centrifugation at 3,000 × g for 5 min at 4°C to harvest the cells each time. For apoptosis detection, the cell pellets were resuspended in 50 μL of binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2) and stained with 5 μL of annexin V-Alexa Fluor 488 and 5 μL of PI for 30 min at room temperature in the dark. For the cell cycle study, the cell pellets were fixed in 200 μL of cold 70% (v/v) ethanol at −20°C overnight, harvested, and washed as described above. The washed cell pellet was then suspended in 250 μL of PBS containing 0.1 mg/mL RNase A and incubated at 37°C for 30 min. Thereafter, it was washed as described above, resuspended in staining buffer (12.5 μL of 1 mg/mL PI in PBS), and incubated at room temperature for 30 min in the dark. The samples were then analyzed by flow cytometry on a FC 500 MPL cytometer (Beckman Coulter, Brea, CA, USA) that recorded 10,000 events per sample. The experiment was performed in triplicate.

Caspase activity assay

The test cells were plated and treated as described above for the apoptosis and cell cycle studies. The treated cells were harvested by trypsinization at 12 and 24 hr and then tested with caspase-3, -8, and -9 colorimetric assay kits (Catalog No. ab39401, ab39700, and ab65608, respectively; Abcam, Cambridge, UK) according to the manufacturer’s instructions. In brief, the harvested cells were washed with cold PBS and centrifuged at 800 × g. The cell pellet was then lysed by the addition of 50 μL of chilled cell lysis buffer and incubation on ice for 10 min. The lysed mixture was clarified by centrifugation at 10,000 × g for 1 min and the supernatant was transferred to a new microcentrifuge tube. The protein concentration in the supernatant of each sample was measured using the Bradford assay and then adjusted to 100 μg of protein per 50 μL of cell lysis buffer for subsequent application to each well of a 96-well plate. Next, 50 μL of 2× reaction buffer containing dithiothreitol at a final concentration of 10 mM was added into each sample well. After mixing, the respective substrate of each caspase was added to each well and the plate was incubated at 37°C for 1–2 hr. Finally, the absorbance of each reaction at 400–405 nm was measured on a microplate reader. Each experiment was performed in triplicate.

Analysis of transcript expression levels by RT-qPCR

The cell lines were treated and processed as described previously for the apoptosis detection assay until the cell pellet was collected. After cell harvesting, total RNA from each sample was extracted using an RNeasy mini kit (Catalog No. 74104; Qiagen, Valencia, CA, USA). The RNA concentration and purity were evaluated by spectrophotometry at an absorbance of 260 and 280 nm, respectively. The RT-qPCR was performed using the One-Step SYBR® PrimeScript™ RT-PCR Kit II (Perfect Real Time; Catalog No. R086A; Takara, Tokyo, Japan). The PCR mixture contained 20 ng of total RNA, 0.4 μM of both forward and reverse primers, 1 μL of PrimeScript™ Enzyme Mix II, and 1× One-Step SYBR® RT-PCR Buffer IV. The nucleotide sequences of the primers used in this study are listed in Table 1.

Amplification and quantification of each gene of interest were performed using the Minicon® system (Bio-Rad, Hercules, CA, USA). Thermocycling was performed as follows. First, the total RNA was reverse transcribed into cDNA at 42°C for 5 min. Then, qPCR was performed with an initial 95°C for 10 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Dissociation analysis was performed to validate the specific product for each primer pair. The expression level of all target genes was normalized to that of GADPH in each sample and compared as the relative expression level between the control and treated samples.

Statistical analysis

Data are presented as the mean ± one standard deviation (1SD), derived from three independent repeats in each experiment. The data were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s multiple-comparisons test for the significance of differences between the means. Significance was accepted at the p < 0.01 and p < 0.05 levels. All analyses were performed using the SPSS version 19.0 program (IBM corporation, Chicago, IL, USA).

RESULTS

In order to determine the cytotoxic IC50 values of α-mangostin, apigenin, and doxorubicin for direct comparison (Table 2, 3, Fig. 1, 2), SKOV-3 ovarian cancer cells were cultured on a small scale (5 × 103 cells in 200 μL of medium in each well of a 96-well plate). With regard to the viability of the treated SKOV-3 cells, α-mangostin, apigenin, and doxorubicin all clearly inhibited cell growth in a dose-dependent manner (Fig. 1). Both apigenin and doxorubicin also showed a time-dependent inhibition, but not α-mangostin. However, at any given time point, α-mangostin was more toxic to the SKOV-3 cells than apigenin was, with the cytotoxicity being 10.8-fold at 24 hr to 5.9-fold higher at 24 and 72 hr, respectively (Table 2). All three compounds affected the number of viable cells and growth of SKOV-3 cells from an early exposure time (24 hr). The longer the exposure to apigenin, the significantly lower was the IC50 value, but the compound still remained less inhibitory than α-mangostin and, especially, doxorubicin.

After 24 hr of exposure, apigenin was nontoxic to CCD-986Sk and WI-38 cells, in contrast to α-mangostin. The IC50 value of apigenin for CCD-986Sk cells was not obtained since it resulted in 70% cell survival even at a high concentration of the compound (92.510 μM) (Fig. 2, Table 3); furthermore, the relative cell survival of 100% detected at 1.156–55.506 μM indicated that apigenin did not affect cell proliferation/survival (Fig. 2B). Likewise for WI-38 cells, apigenin at 1.156–2.313 μM did not affect the cell growth, and a concentration of up to 27.753 μM was nontoxic to the cells (Fig. 2B). Although α-mangostin was toxic to CCD-986Sk cells, the cytotoxicity was about 4-fold less than that in SKOV-3 cells. As with apigenin, the IC50 value of doxorubicin for CCD-986Sk cells was not obtained since the compound did not affect the growth of this cell line. However, for WI-38 cells, doxorubicin was more cytotoxic than α-mangostin (Table 3).

For all the other experiments, the SKOV-3 cells were cultured on a larger scale at 5 × 105 cells in 5 mL of medium in T25 flasks. Since α-mangostin treatment of the SKOV-3 cells at the IC50 value obtained from the small-scale (200 μL) culture (Table 2) was not effective at all in the larger-scale cultures, the concentration of α-mangostin was increased to 3× the IC50 value. The most obvious changes observed are summarized in Fig. 37. Hence, the potency of α-mangostin at any given concentration depended directly on the density and amount of cells as well as its dose. This phenomenon has been reported before (2224). Morphological changes in the treated SKOV-3 cells were evident at the later exposure times compared with the control (DMSO-treated cells). After 24 hr of exposure, the SKOV-3 cells treated with each test compound looked somewhat similar to the control cells; however, after 48 and 72 hr, the treated cells had a lower cell density and a higher proportion of unadhered and round cells (Fig. 3A). At the higher magnification of 200×, it was evident that after 48 hr of exposure, the α-mangostin-treated SKOV-3 cells were mostly damaged, with very few spindle-shaped cells present. Cell shrinkage was observed in the α-mangostin-and apigenin-treated SKOV-3 cells, whereas some cell blebbing was seen in the doxorubicin-treated cells. In addition, the apigenin- and doxorubicin-treated SKOV-3 cells had more vacuoles (Fig. 3B).

Since a lower density of cells was observed after a longer exposure to α-mangostin, apigenin, and doxorubicin, suggesting cell death as well as inhibition of proliferation, the possibility of the induction of programmed cell death was further investigated. The SKOV-3 cells were treated with the same concentration of each reagent as used for evaluating the change in morphology. Programmed cell death can be analyzed by staining target cells with annexin V and PI, whereas cell cycle arrest can be investigated by staining target cells with PI alone. In both cases, the staining level for each cell can be quantitatively determined using flow cytometry.

Since apoptosis causes a loss of membrane phospholipid asymmetry (25), the phosphatidylserine that is normally located in the cytosol is flipped outside, allowing annexin V (conjugated with Alexa fluor 488) to bind to it. Thus, the annexin V-Alexa fluor 488 conjugate can bind to apoptotic but not to viable cells. At a longer time beyond death, necrotic cells have an even more damaged and leaky membrane that allows PI to pass into the nucleus and bind to the DNA. Thus, viable cells are negative for both annexin V-Alexa fluor 488 and PI staining, showing only autofluorescence. Apoptotic cells will be positive for annexin V-Alexa fluor 488 (green fluorescence) but negative for PI staining, whereas necrotic cells will be positive for both annexin V-Alexa fluor 488 and PI staining (red and green fluorescence, respectively) (26). Flow cytometry can also be used to quantitatively analyze cell cycle arrest, where the amount of bound PI (and thus red fluorescence) equates to the amount of DNA; thus, the cell cycle position (sub-phases G1, S, and G2/M) is identified by the DNA content through PI staining.

After staining with annexin V-Alexa fluor 488 and PI, it was evident that apigenin had caused a significant level of early and late apoptosis from 24 hr onwards, but with less early apoptosis at the later time points, and subsequently caused significant necrosis, especially at 72 hr (Fig. 4). On the other hand, doxorubicin caused a significant level of both late apoptosis and necrosis, but only after a longer exposure of 72 hr. Although α-mangostin gave a similar result to doxorubicin, the level of necrosis was significantly increased and detected slightly earlier (from 48 hr) than the 72 hr time span for the other compounds (Fig. 4).

From Fig. 4, it was evident that the programmed cell death of the SKOV-3 cells was induced by each of the three compounds and that it involved apoptosis (early and/or late). Hence, apoptosis was further investigated by evaluating the cellular caspase activity. As is known, both caspase-8 and caspase-9 are involved in the intrinsic pathway, whereas the apoptosis-mediating caspase-3 is involved in both the extrinsic and intrinsic pathways. Herein, the very early exposure time (12 and 24 hr) to each compound was evaluated. The activity of caspase-3 was significantly (p < 0.05) increased in the α-mangostin-treated SKOV-3 cells after 12 hr of exposure, while its activity was also significantly (p < 0.01) increased in both the α-mangostin- and apigenin-treated cells after 24 hr of exposure, but the numerical increase observed in the doxorubicin-treated cells was not significant (Fig. 5). Caspase-8 activity was not significantly changed by all three treatments at both time points. Although the caspase-9 level was numerically increased in all treatments at 24 hr, it was only statistically significant (p < 0.01) for the apigenin-treated SKOV-3 cells. Thus, it may be possible that the early apoptosis induced by apigenin in SKOV-3 cells at 24 hr was influenced by the intrinsic pathway.

Next, we evaluated if cell cycle arrest was induced in the SKOV-3 cells by these compounds. After 24 hr of exposure, α-mangostin had induced arrest at the G2/M phase (p < 0.01), whereas apigenin likewise arrested the cells only after 48 hr of exposure (Fig. 6). Thus, α-mangostin caused cell cycle arrest faster than apigenin, which concurs with α-mangostin being more toxic to the SKOV-3 cells (Table 2).

To determine in deeper detail how α-mangostin and apigenin affect the proliferation or death of SKOV-3 cells, changes in the transcript expression levels of selected genes from four groups were investigated. The first group was inflammation-associated genes, of which cyclooxygenase 2 (COX2) and nuclear factor kappa B (NFκB) were representatives. The second group was proto-oncogenes, from which catenin beta 1 (CTNNB1) was selected. The third group was autophagy-associated genes, with cathepsin B (CTSB) being a representative. The last group was apoptosis-associated genes, from which B-cell lymphoma 2 (BCL2), and the caspase genes CASP3, CASP7, CASP8, and CASP9 were selected. The data are summarized in Fig. 7. Although a trend of mostly an increase in the gene expression level relative to that in the control cells was numerically observed for all tested genes (except for NFκB) among the different treatments, the upregulation was significant only for BCL2 (p < 0.01) and COX2 (p < 0.05) in the apigenin- and α-mangostin-treated SKOV-3 cells, respectively.

DISCUSSION

α-Mangostin extracted from the cerumen of Tetragonula laeviceps was reported to have potent cytotoxicity against several types of cancer cell lines, including the breast cancer BT474, undifferentiated lung cancer Chago, hepatoblastoma Hep-G2, gastric carcinoma KATO-III, and colon adenocarcinoma SW620 cell lines, with IC50 values that ranged from 0.88 ± 0.16 to 2.25 ± 0.20 μM (12). Some of the molecular details on how α-mangostin inhibits the growth of BT474 cells have been under continuous study in our laboratory. With some congruence, breast and gynecological cancers, especially ovarian cancer, have been reported to be related to each other owing to their similar genetic basis (27), while a patient with breast cancer was later found to have primary ovarian small cell carcinoma and endometrioid adenocarcinoma of the uterus (28). Indeed, an increased risk of breast and ovarian cancers has been reported to be associated with germline mutations in BRCA1 and BRCA2 (29). This led us to investigate the role of α-mangostin in SKOV-3 ovarian cancer cells.

There have been diverse reports that oxidative stress, chronic inflammation, and cancer are closely linked (3032). Not only do reactive oxygen species (which cause oxidative stress in cells) damage biological molecules, but they can also lead to chronic inflammation and eventually mediate chronic diseases such as cancer (30). In addition, the oxidative stress caused by the abnormal activation of nuclear factor E2-related factor 2 due to epigenetic alterations can increase anticancer drug resistance (33). Thus, finding an antioxidant or a free-radical-scavenging compound is likely to be beneficial for preventing cancer. Apigenin is a major compound extracted from Apis mellifera bee pollen and was reported to have free-radical-scavenging activity (14). Thus, in this work, we evaluated if it could inhibit the growth of SKOV-3 ovarian cancer cells.

Different naturally occurring compounds can inhibit the growth of SKOV-3 cells to different extents and potentially by different mechanisms. In this work, apigenin was clearly toxic to SKOV-3 cells but not to normal cells. α-Mangostin showed an almost similar toxicity as that of doxorubicin to SKOV-3 cells, but it was unfortunately also toxic to the WI-38 normal lung fibroblasts. α-Mangostin at less than 6.091 μM was safe for CCD-986Sk skin fibroblasts (Table 3). Thus, the cell-type specificity is of concern and has been reported before (3437). Although α-mangostin was more toxic than doxorubicin to the normal CCD-986Sk skin fibroblasts, it was less toxic than doxorubicin to the normal WI-38 lung fibroblasts. Aside from the data obtained indicating that finding an alternative compound for the antiproliferation of SKOV-3 cancer cells is still needed, the application of α-mangostin in broad systemic application for cancer prevention and treatment must be of some concern. It has been suggested that the plant-based metallic nanoparticles synthesized from Abutilon inducum, Butea monosperma, Gossypium hirsutum, Indoneesiella echioides, and Melia azedarach were toxic to cancer cells and not to normal cells (38).

Because both α-mangostin and apigenin induced apoptosis, but after different exposure times, the activities of caspase-3, -8, and -9 were assayed. Although late apoptosis and necrosis were clearly detected after 72 hr, the significant increase in activity of caspase-3 (the final executor of apoptosis and the most significant member of the apoptotic pathway) was investigated after a 12-hr exposure in order to optimize the detection of this early apoptotic response. After exposure for 24 hr, the transcript expression level of COX2 (inflammation-associated gene) was significantly upregulated, whereas that of NFκB remained the same as in the control cells. Thus, by 24 hr, the promotion of apoptosis in α-mangostin-treated SKOV-3 cancer cells had not reduced the inflammatory response. However, the changes in gene expression should be observed after longer exposures to α-mangostin, since NFκB plays a role in activating many inflammatory factors, such as TNF-α, interleukin (IL)-6, IL-8, matrix metalloproteinase, COX2, and nitric oxide synthase (39). It, therefore, remains plausible that α-mangostin may affect the expression of NFκB earlier (faster) than COX2.

For apigenin-treated SKOV-3 cancer cells, significantly increased caspase-9 activity was detected after 24 hr of exposure, which is the same timing as the onset of early apoptosis. Hence, the death of apigenin-treated SKOV-3 cells was likely to have been induced by the intrinsic pathway.

The expression of BCL2 (an anti-apoptotic gene) transcripts, but not those of CTNNB1 (a proto-oncogene), was significantly upregulated by apigenin, implying that other biomolecules or pathways are involved in this apoptotic process. This notion is potentially supported by Otake et al. (40), who reported that the overexpression of BCL2 in lymphocytes alone did not cause cancer, whereas the simultaneous overexpression of BCL2 and MYC (a proto-oncogene) could induce aggressive B-cell malignancies, including lymphoma. However, berbamine, isolated from the Berberis amurensis plant, could suppress the growth and invasion of the human ovarian cancer cell lines SKOV-3 and ES2 by inducing apoptosis via the increased activity of caspase-3 and -9 and the decreased expression of BCL2 (3).

In the future, in order to enhance the efficacy of α-mangostin and apigenin as chemotherapeutic agents for ovarian cancer, other application approaches could be applied, such as with fatty acid-conjugated compounds (41), or the synergistic inhibition induced by co-administration with other promising compounds (42). Moreover, the toxicity of these compounds in an in vivo model system, such as the rat, should be determined (43,44).

ACKNOWLEDGMENTS

This work was financially supported by Chulalongkorn University, the Doctoral Degree Chulalongkorn University 100th Year Birthday Anniversary, the 90th Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund), Sci-Super IV_61_003, and the Overseas Research Experience Scholarship for Graduate Student.

ABBREVIATIONS
BCL2: B-cell lymphoma 2
CASP: Caspase
COX2: Cyclooxygenase 2
CTNNB1: Catenin beta 1
CTSB: Cathepsin B
GADPH: Glyceraldehyde 3-phosphate dehydrogenase
IL: Interleukin
NFκB: Nuclear factor kappa B.
Figures
Fig. 1. Toxicity of (A) α-mangostin, (B) apigenin, and (C) doxorubicin in SKOV-3 cells. Cell survival (%) was estimated after treatment for 24, 48, and 72 hr (blue, orange, and grey lines, respectively). Data are shown as the mean ± 1SD, derived from three independent repeats.
Fig. 2. Toxicity of (A) α-mangostin, (B) apigenin, and (C) doxorubicin in CCD-986Sk skin fibroblasts (blue line) and WI-38 lung fibroblasts (orange line). Cell survival (%) was estimated after 24 hr of treatment. Data are shown as the mean ± 1SD, derived from three independent repeats.
Fig. 3. Morphology of SKOV-3 cells treated with 0.1% (v/v) dimethyl sulfoxide (DMSO) alone or DMSO containing α-mangostin (7.309 μM), apigenin (18.502 μM), or doxorubicin (0.431 μM) for (A) 24, 48, and 72 hr (100× magnification) and (B) after 48 hr (200× magnification). Images shown are representative of those seen from at least three such fields of view per sample and three independent repeats.
Fig. 4. Flow cytometric analysis of SKOV-3 cells stained for annexin-V and propidium iodide (PI) after incubation of cells in 0.1% (v/v) dimethyl sulfoxide (DMSO) alone or DMSO containing α-mangostin (7.309 μM), apigenin (18.502 μM), or doxorubicin (0.431 μM) for 24, 48, and 72 hr. (A) FACS profiles and (B) derived histogram analyses are shown for 10,000 events and are representative of those seen from three replications. * and ** represent a significant difference between the control and treated cells at p < 0.05 and p < 0.01, respectively.
Fig. 5. Relative caspase activity in doxorubicin-, α-mangostin-, and apigenin-treated SKOV-3 cells. Cells were treated with 0.1% (v/v) dimethyl sulfoxide (DMSO) alone (control) or DMSO containing α-mangostin (7.309 μM), apigenin (18.502 μM), or doxorubicin (0.431 μM) for 12 and 24 hr and then assayed for (A) caspase-8, (B) caspase-9, and (C) caspase-3 activity. Data are shown as the mean ± 1SD, derived from three replications, where * and ** represent a significant difference between the control and treated cells at p < 0.05 and p < 0.01, respectively.
Fig. 6. Cell cycle arrest of SKOV-3 cells after treatment with 0.1% (v/v) dimethyl sulfoxide (DMSO) alone (control) or DMSO containing α-mangostin (7.309 μM) or apigenin (18.502 μM) for 24, 48, and 72 hr. (A) Flow cytometric histograms (5,000 events) representative of those seen from three replications, and (B) the derived mean % (± 1SD) of cells in each phase of the cell cycle after 24, 48, and 72 hr treatment. * and ** represent a significant difference between the control and treated cells at p < 0.05 and p < 0.01, respectively.
Fig. 7. Changes in the transcript expression levels of the selected inflammation-associated genes (COX2 and NFκB), proto-oncogene (CTNNB1), autophagy-associated gene (CTSB), and apoptosis-associated genes (BCL2, CASP3, CASP7, CASP8, and CASP9). SKOV-3 cells were cultured with 0.1% (v/v) dimethyl sulfoxide (DMSO) alone (control) or DMSO containing α-mangostin (7.309 μM), apigenin (18.502 μM), or doxorubicin (0.431 μM) for 24 hr. Data are shown as the mean ± 1SD, derived from three independent repeats. * and ** represent a significant difference between the control and treated cells in each group at p < 0.05 or p<0.01, respectively.
TABLES

Table 1

Targeted genes and primers used for their amplification by RT-qPCR

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
Reference gene
GADPH GGGCATCCTGGGCTACTCTG GAGGTCCACCACCCTGTTGC

Inflammation-associated genes
COX2 TCTGCAGAGTTGGAAGCACTCTA GCCGAGGCTTTTCTACCAGAA
NFκB ATGGCTTCTATGAGGCTGAG GTTGTTGTTGGTCTGGATGC

Proto-oncogene
CTNNB1 CTTGTGCGTACTGTCCTTCG AGTGGGATGGTGGGTGTAAG

Autophagy-associated gene
CTSB CAGCGTCTCCAATAGCGA AGCCCAGGATGCGGAT

Apoptosis-associated genes
BCL2 ATGTGTGTGGAGACCGTCAA GCCGTACAGTTCCACAAAGG
CASP3 TGTTTGTGTGCTTCTGAGCC CACGCCATGTCATCATCAAC
CASP7 CCAATAAAGGATTTGACAGCC GCATCTGTGTCATTGATGGG
CASP8 GATCAAGCCCCACGATGAC CCTGTCCATCAGTGCCATAG
CASP9 CATTTCATGGTGGAGGTGAAG GGGAACTGCAGGTGGCTG

GADPH, glyceraldehyde 3-phosphate dehydrogenase; COX2, cyclooxygenase 2; NFκB, nuclear factor kappa B; CTNNB1, catenin beta 1; CTSB, cathepsin B; BCL2, B-cell lymphoma 2; CASP, caspase.


Table 2

IC50 values of α-mangostin, apigenin, and doxorubicin for SKOV-3 cells

Compound IC50 value (μM) at an incubation time of:

24 hr 48 hr 72 hr
α-Mangostin 2.466 ± 0.338 2.977 ± 0.054 3.062 ± 0.349
Apigenin 26.538 ± 6.024 21.175 ± 5.249** 18.197 ± 3.095**
Doxorubicin 0.534 ± 0.084 0.343 ± 0.023 0.117 ± 0.008

**

Indicates a significant difference to the IC50 value of 24 hr when treated with the same compound.


Table 3

IC50 values of α-mangostin, apigenin, and doxorubicin for CCD-968Sk and WI-38 cells after 24 hr of treatment

Compound IC50 value (μM)

CCD-986Sk cells WI-38 cells
α-Mangostin 9.805 ± 3.169 1.502 ± 0.464
Apigenin ND 36.873 ± 0.971
Doxorubicin ND 0.604 ± 0.156

ND = not determined.


References
  1. Reid, BM, Permuth, JB, and Sellers, TA (2017). Epidemiology of ovarian cancer: a review. Cancer Biol Med. 14, 9-32.
  2. Li, JX, Bi, YP, Wang, J, Yang, X, Tian, YF, and Sun, ZF (2018). JTC-801 inhibits the proliferation and metastasis of ovarian cancer cell SKOV3 through inhibition of the PI3K - AKT signaling pathway. Pharmazie. 73, 283-287.
    Pubmed CrossRef
  3. Zhang, H, Jiao, Y, Shi, C, Song, X, Chang, Y, Ren, Y, and Shi, X (2018). Berbamine suppresses cell proliferation and promotes apoptosis in ovarian cancer partially via the inhibition of Wnt/β-catenin signaling. Acta Biochim Biophys Sin (Shanghai). 50, 532-539.
    Pubmed CrossRef
  4. Liotta, LA, Steeg, PS, and Stetler-Stevenson, WG (1991). Cancer metastasis and angiogenesis: animbalance of positive and negative regulation. Cell. 64, 327-336.
    CrossRef
  5. Luvero, D, Plotti, F, Lopez, S, Scaletta, G, Capriglione, S, Montera, R, Antonelli, G, Ciuffreda, S, Carassiti, R, Oliveti, A, and Angioli, R (2017). Antiangiogenics and immunotherapies in cervical cancer: an update and future’s view. Med Oncol. 34, 115.
    Pubmed CrossRef
  6. Ayla, Ş, Bilir, A, Ertürkoğlu, Ş, Tanrıverdi, G, Soner, BC, Sofuoğlu, K, Ghisolfi, L, and Öktem, G (2018). Effects of different drug treatments on the proliferation of human ovarian carcinoma cell line MDAH-774. Turk J Med Sci. 48, 441-448.
    Pubmed CrossRef
  7. Rahman, N, Jeon, M, Song, HY, and Kim, YS (2016). Cryptotanshinone, a compound of Salvia miltiorrhiza inhibits pre-adipocytes differentiation by regulation of adipogenesis-related genes expression via STAT3 signaling. Phytomedicine. 23, 58-67.
    Pubmed CrossRef
  8. Zhang, Y, Chen, S, Wei, C, Rankin, GO, Rojanasakul, Y, Ren, N, Ye, X, and Chen, YC (2018). Dietary Compound Proanthocyanidins from Chinese bayberry (Myrica rubra Sieb. et Zucc.) leaves inhibit angiogenesis and regulate cell cycle of cisplatin-resistant ovarian cancer cells via targeting Akt pathway. J Funct Foods. 40, 573-581.
    Pubmed KoreaMed CrossRef
  9. Zhang, Q, Dong, J, Cui, J, Huang, G, Meng, Q, and Li, S (2018). Cytotoxicity of synthesized 1,4-naphthoquinone oxime derivatives on selected human cancer cell lines. Chem Pharm Bull. 66, 612-619.
    Pubmed CrossRef
  10. Puglisi, MP, Bradaric, MJ, Pontikis, J, Cabai, J, Weyna, T, Tednes, P, Schretzman, R, Rickert, K, Cao, Z, and Andrei, D (2018). Novel primary amine diazeniumdiolates-Chemical and biological characterization. Drug Dev Res. 79, 136-143.
    Pubmed CrossRef
  11. Tsai, SY, Chung, PC, Owaga, EE, Tsai, IJ, Wang, PY, Tsai, JI, Yeh, TS, and Hsieh, RH (2016). Alpha-mangostin from mangosteen (Garcinia mangostana Linn.) pericarp extract reduces high fat-diet induced hepatic steatosis in rats by regulating mitochondria function and apoptosis. Nutr Metab (Lond). 13, 88.
    Pubmed KoreaMed CrossRef
  12. Nugitrangson, P, Puthong, S, Iempridee, T, Pimtong, W, Pornpakakul, S, and Chanchao, C (2016). In vitro and in vivo characterization of the anticancer activity of Thai stingless bee (Tetragonula laeviceps) cerumen. Exp Biol Med. 241, 166-176.
    Pubmed KoreaMed CrossRef
  13. Sándor, Z, Mottaghipisheh, J, Veres, K, Hohmann, J, Bencsik, T, Horváth, A, Kelemen, D, Papp, R, Barthó, L, and Csupor, D (2018). Evidence supports tradition: the in vitro effects of Roman chamomile on smooth muscles. Front Pharmacol. 9, 323.
    Pubmed KoreaMed CrossRef
  14. Chantarudee, A, Phuwapraisirisan, P, Kimura, K, Okuyama, M, Mori, H, Kimura, A, and Chanchao, C (2012). Chemical constituents and free radical scavenging activity of corn pollen collected from Apis mellifera hives compared to floral corn pollen at Nan, Thailand. BMC Complement Altern Med. 12, 45.
    Pubmed KoreaMed CrossRef
  15. Sivaranjani, M, Srinivasan, R, Aravindraja, C, KaruthaPandian, S, and Veera Ravi, A (2018). Inhibitory effect of α-mangostin on Acinetobacter baumannii biofilms - an in vitro study. Biofouling. 34, 579-593.
    Pubmed CrossRef
  16. Chen, G, Li, Y, Wang, W, and Deng, L (2018). Bioactivity and pharmacological properties of α-mangostin from the mangosteen fruit: a review. Expert Opin Ther Pat. 28, 415-427.
    Pubmed CrossRef
  17. Kumar, KS, Sabu, V, Sindhu, G, Rauf, AA, and Helen, A (2018). Isolation, identification and characterization of apigenin from Justicia gendarussa and its anti-inflammatory activity. Int Immunopharmacol. 59, 157-167.
    Pubmed CrossRef
  18. Abu Bakar, FI, Abu Bakar, MF, Rahmat, A, Abdullah, N, Sabran, SF, and Endrini, S (2018). Anti-gout potential of Malaysian medicinal plants. Front Pharmacol. 9, 261.
    Pubmed KoreaMed CrossRef
  19. El Habbash, AI, Mohd Hashim, N, Ibrahim, MY, Yahayu, M, Omer, FAE, Abd Rahman, M, Nordin, N, and Lian, GEC (2017). In vitro assessment of anti-proliferative effect induced by α-mangostin from Cratoxylum arborescens on HeLa cells. PeerJ. 5, e3460.
    Pubmed KoreaMed CrossRef
  20. Suh, YA, Jo, SY, Lee, HY, and Lee, C (2015). Inhibition of IL-6/STAT3 axis and targeting Axl and Tyro3 receptor tyrosine kinases by apigenin circumvent taxol resistance in ovarian cancer cells. Int J Oncol. 46, 1405-1411.
    Pubmed CrossRef
  21. Tang, AQ, Cao, XC, Tian, L, He, L, and Liu, F (2015). Apigenin inhibits the self-renewal capacity of human ovarian cancer SKOV3-derived sphere-forming cells. Mol Med Rep. 11, 2221-2226.
    Pubmed CrossRef
  22. Niu, W, Chen, F, Wang, J, Qian, J, and Yan, S (2017). Antitumor effect of sikokianin C, a selective cystathionine β-synthase inhibitor, against human colon cancer in vitro and in vivo. Medchemcomm. 9, 113-120.
    Pubmed KoreaMed CrossRef
  23. Fang, A, Zhang, Q, Fan, H, Zhou, Y, Yao, Y, Zhang, Y, and Huang, X (2017). Discovery of human lactate dehydrogenase A (LDHA) inhibitors as anticancer agents to inhibit the proliferation of MG-63 osteosarcoma cells. MedChem-Comm. 8, 1720-1726.
    Pubmed KoreaMed CrossRef
  24. Xu, X, Rawling, T, Roseblade, A, Bishop, R, and Ung, AT (2017). Antiproliferative activities of alkaloid-like compounds. MedChemComm. 8, 2105-2114.
    Pubmed KoreaMed CrossRef
  25. Koopman, G, Reutelingsperger, CP, Kuijten, GA, Keehnen, RM, Pals, ST, and van Oers, MH (1994). Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood. 84, 1415-1420.
    Pubmed
  26. Schutte, B, Nuydens, R, Geerts, H, and Ramaekers, F (1998). Annexin V binding assay as a tool to measure apoptosis in differentiated neuronal cells. J Neurosci Methods. 86, 63-69.
    CrossRef
  27. Easton, DF, Bishop, DT, Ford, D, and Crockford, GP (1993). Genetic linkage analysis in familial breast and ovarian cancer: results from 214 families. The Breast Cancer Linkage Consortium. Am J Hum Genet. 52, 678-701.
    Pubmed KoreaMed
  28. Yin, L, Li, J, Wei, Y, Ma, D, Sun, Y, and Sun, Y (2018). Primary ovarian small cell carcinoma of pulmonary type with coexisting endometrial carcinoma in a breast cancer patient receiving tamoxifen: A case report and literature review. Medicine (Baltimore). 97, e10900.
    Pubmed KoreaMed CrossRef
  29. Zhang, L, Shin, VY, Chai, X, Zhang, A, Chan, TL, Ma, ES, Rebbeck, TR, Chen, J, and Kwong, A (2018). Breast and ovarian cancer penetrance of BRCA1/2 mutations among Hong Kong women. Oncotarget. 9, 25025-25033.
    Pubmed KoreaMed CrossRef
  30. Reuter, S, Gupta, SC, Chaturvedi, MM, and Aggarwal, BB (2010). Oxidative stress, inflammation, and cancer: how are they linked?. Free Radic Biol Med. 49, 1603-1616.
    Pubmed KoreaMed CrossRef
  31. Weinberg, F, and Chandel, NS (2009). Reactive oxygen species-dependent signaling regulates cancer. Cell Mol Life Sci. 66, 3663-3673.
    Pubmed CrossRef
  32. Chan, DW, Liu, VW, Tsao, GS, Yao, KM, Furukawa, T, Chan, KK, and Ngan, HY (2008). Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells. Carcinogenesis. 29, 1742-1750.
    Pubmed CrossRef
  33. Kang, KA, and Hyun, JW (2017). Oxidative stress, Nrf2 and epigenetic modification contribute to anticancer drug resistance. Toxicol Res. 33, 1-5.
    Pubmed KoreaMed CrossRef
  34. Yurdacan, B, Egeli, U, Eskiler, GG, Eryilmaz, IE, Cecener, G, and Tunca, B (2018). The role of usnic acid-induced apoptosis and autophagy in hepatocellular carcinoma. Hum Exp Toxicol.
    Pubmed CrossRef
  35. Boehning, AL, Essien, SA, Underwood, EL, Dash, PK, and Boehning, D (2018). Cell type-dependent effects of ellagic acid on cellular metabolism. Biomed Pharmacother. 106, 411-418.
    Pubmed KoreaMed CrossRef
  36. Hu, Y, Li, X, An, Y, Duan, J, and Yang, XD (2018). Selection of a novel CD19 aptamer for targeted delivery of doxorubicin to lymphoma cells. Oncotarget. 9, 26605-26615.
    Pubmed KoreaMed CrossRef
  37. Hupe, MC, Hoda, MR, Zengerling, F, Perner, S, Merseburger, AS, and Cronauer, MV (2018). The BET-inhibitor PFI-1 diminishes AR/AR-V7 signaling in prostate cancer cells. World J Urol.
    Pubmed CrossRef
  38. Hanan, NA, Chiu, HI, Ramachandran, MR, Tung, WH, MohamadZain, NN, Yahaya, N, and Lim, V (2018). Cytotoxicity of plant-mediated synthesis of metallic nanoparticles: a systematic review. Int J Mol Sci. 19, E1725.
    Pubmed KoreaMed CrossRef
  39. Vallée, A, and Lecarpentier, Y (2018). Crosstalk between peroxisome proliferator-activated receptor gamma and the canonical wnt/β-catenin pathway in chronic inflammation and oxidative stress during carcinogenesis. Front Immunol. 9, 745.
    Pubmed KoreaMed CrossRef
  40. Otake, Y, Soundararajan, S, Sengupta, TK, Kio, EA, Smith, JC, Pineda-Roman, M, Stuart, RK, Spicer, EK, and Fernandes, DJ (2007). Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of bcl2 mRNA. Blood. 109, 3069-3075.
    Pubmed KoreaMed CrossRef
  41. Shibata, MA, Hamaoka, H, Morimoto, J, Kanayama, T, Maemura, K, Ito, Y, Iinuma, M, and Kondo, Y (2018). Synthetic α-mangostin dilaurate strongly suppresses wide-spectrum organ metastasis in a mouse model of mammary cancer. Cancer Sci. 109, 1660-1671.
    Pubmed KoreaMed CrossRef
  42. Xia, Y, and Sun, J (2018). Synergistic inhibition of cell proliferation by combined targeting with kinase inhibitors and dietary xanthone is a promising strategy for melanoma treatment. Clin Exp Dermatol. 43, 149-157.
    Pubmed CrossRef
  43. Nurul, SAS, Hazilawati, H, Mohd, RS, Mohd, FHR, Noordin, MM, and Norhaizan, ME (2018). Subacute oral toxicity assessment of ethanol extract of Mariposa christiavespertilionis leaves in male Sprague Dawley rats. Toxicol Res. 34, 85-95.
    Pubmed KoreaMed CrossRef
  44. Lee, Y (2017). Cancer chemopreventive potential of procyanidin. Toxicol Res. 33, 273-282.
    Pubmed KoreaMed CrossRef


e-submission

This Article


Cited By Articles
  • CrossRef (0)

Funding Information

Services

Archives