Traditional herbal medicines are naturally occurring, plant-derived substances with minimal or no industrial processing, and have been historically used to treat illnesses in local or regional healing practices (1). The word “traditional” means that the herbal product is intended and designed for administration via the oral route without intervention from a registered medical practitioner for diagnosis, monitoring, or treatment (2). Saposhnikoviae Radix (Bang Fung in Korean; Fang-Feng in Chinese; siler in English) is a dried root from the perennial herb Saposhnikovia divaricate (Turcz.) Schischk. of the family Umbelliferae. It has been widely used as a traditional medicine for alleviating inflammation, rheumatic conditions, spasms, and other ailments in East Asia (3–7). Numerous active compounds with pharmaceutical potential have been identified in Saposhnikoviae Radix, including chromones (prim-O-glucosylcimifugin, 4′-O-β-d-glucosyl-5-O-methylvisamminol, 3′-O-angeloylhamaudol, sec-O-glucosylhamaudol, and cimifugin), and coumarins (nodakenin, psoralen, bergapten, imperatorin, phellopterin, and anomalin), among others (4,8,9). Coumarins represent a substantial class of condensed heterocycles that manifest a miscellanea of significant biological activities, including anti-inflammatory (10), antioxidant, anti-adipogenic, anticancer, antiviral, anticoagulant, and neuroprotective properties (11). Saposhnikoviae Radix contains several chromones and a variety of coumarins, including nodakenin, anomalin, diphenols, acid esters, and polyacetylene, among others (3). Nodakenin has been widely used as a marker compound for the separation of constituents from the Saposhnikoviae Radix extract (9,12,13).

In addition to easy access, therapeutic efficacy, and relatively low cost of traditional medicines, ultimately, safety concerns are most important in order to adapt existing treatments for clinical use and to develop new products. It is believed that Saposhnikoviae Radix, the dried root of Saposhnikovia divaricata (Turcz.) Schischk. (Umbelliferae), is a top-grade source of herbal medicine, though its toxicity is not well established (14,15). In this research, the toxicity of a water extract of Saposhnikoviae Radix (SRE) was determined by assessing single-dose toxicity, subchronic 4-week repeated-dose range finding (DRF) toxicity, and chronic 13-week subchronic toxicity in male and female Crl:CD (SD) rats. In addition, we tested the temporal stability of SRE depending on storage temperature (4°C or room temperature) for up to one year, because the amounts of active compounds in herbal medicines can be altered by storage conditions, which can decrease their therapeutic efficacy (16).

There is an increasing trend in the prevalence of hyperuricemia and gout in the Western world. In fact, a number of population-based studies estimate a prevalence of up to 21% for hyperuricemia and 1–4% for gout (17). Uric acid (UA) is a metabolite obtained from purine by the activity of xanthine oxidase (XO), and high levels of serum UA lead to hyperuricemia and gout. Although allopurinol, a XO inhibitor, and benzbromarone, an inhibitor of protein transporter of urate (URAT1) are considered safe first-line drugs in gout, side effects such as liver toxicity, gastrointestinal disorders, and skin rash can occur (17). To describe the potential of SRE against hyperuricemia, the effect of SRE on serum UA, serum creatine, urinary UA, and urinary XO activity were determined in potassium oxonate (PO)-induced gout mice (18,19). In addition, the histological evaluation of the kidney was conducted to identify the beneficial role of SRE on PO-induced kidney injury in mice.

Study guidelines

Animal experiments were approved by the animal care and use committee at the Korea conformity laboratory (GT15-00418). All experiments were designed and conducted under the Organization for Economic Cooperation and Development (OECD) test guidelines No. 413, Good Laboratory Practice (GLP), and the Korean Ministry of Food and Drug Safety (KMFDS) Notice No. 2013-121 (Toxicity test standards of medicine and medical supplies). Although this study was not conducted under Good Laboratory Practice (GLP) regulations, general procedures in this study were performed according to the standard operation procedures (SOPs) of the GLP compliance testing facility.

Chemicals and reagents

Methanol, water, and acetonitrile of high-performance liquid chromatography (HPLC) grade were obtained from Honeywell Burdick & Jackson (Morris Plains, NJ, USA). Trifluoroacetic acid, oxonic acid potassium salt (potassium oxonate), allopurinol, benzbromarone, and an XO activity assay kit were purchased from Sigma-Aldrich (St. Louis, MO, USA). Nodakenin (CAS Number 495-31-8) was purchased from ChemFaces (Wuhan, Hubei, China). A UA assay kit was obtained from YD Diagnostics (Yongin, Korea).

Phylogenetic analysis of Saposhnikoviae Radix

Saposhnikoviae Radix was obtained from the Kyungdong Yangnyeong-si market (Seoul, Korea). The specimen was scrutinized by Professor Se Chan Kang (Kyung Hee University, Yongin, Korea). A voucher specimen of the plant material was deposited at the Kyung Hee University of Oriental Medicine Biotechnology (Yongin, Korea). Due to morphological similarities when dried, the authenticity of Saposhnikoviae Radix was determined by phylogenetic analysis based on internal transcribed spacer (ITS) sequence alignment and genetic analysis. Briefly, total DNA extraction was achieved using a HiYield™ Genomic DNA Mini Kit (RBC Bioscience Co., Taipei, Taiwan). The primers used for regions and the PCR conditions were as follows: ITS2: S2F, ATGCGATACTTGGTGTGAAT; S3R, GACGCTTCTCCAGACTACAAT; PCR conditions: 94°C for 5 min; 40 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 45 sec; and 72°C for 10 min. An ABI Prism 3730xl DNA sequencer (Applied Biosystems, Foster City, CA, USA) was used to trim and assemble raw trace files. A BLAST analysis was performed using the nucleotide database at the National Center for Biotechnology Information (NCBI). Intra- and inter-species genetic distances were obtained with the Kimura-2-parameter (K2P) model of MEGA 6.00 (20). Intra- and inter-species pairwise divergences were calculated as a barcoding gap using TAXON DNA (21). A neighbor-joining tree based on the phylogenetic analysis was constructed with 1000 replicate bootstrap tests in order to identify Saposhnikoviae Radix via MEGA 6.0. (20).

Preparation of the water extract of Saposhnikoviae Radix

Saposhnikoviae Radix (500 g) was selected based on 100% phylogenetic similarity and was subjected to hot water extraction for 4 hr. The water extract of Saposhnikoviae Radix (SRE) was prepared after the filtration with Whatman Qualitative No. 1 filter paper and subsequent concentration by a rotary evaporator (Eyela, Tokyo, Japan) at 40°C. Water for oral delivery (lot L4P4K21, Dae Han Pharm. Co., LTD, Seoul, Korea) was used as a vehicle and negative control. The SRE suspension was prepared once per day and mixed just prior to each administration.

High-performance liquid chromatogram (HPLC)

Nodakenin (C₂₀H₂₄O₉) is one of the coumarins identified in Saposhnikoviae Radix (9,22). In addition to the phylogenetic analysis, an HPLC analysis was performed using nodakenin as a reference compound for determining the authenticity of Saposhnikoviae Radix. Nodakenin (500 μg/mL) was solubilized in methanol and serially diluted to 50, 5, and 0.5 μg/mL solutions. After the filtration, the SRE was solubilized in water (250 mg/mL) and was further diluted to concentrations of 10 and 1 mg/mL with methanol. The SHIMADZU LC 20AD HPLC system (Kyoto, Japan) was used with a PDA detector set at 335 nm. An ACE C₁₈ column was used (250 mm × 4.6 mm, 5 μM) at a temperature of 40°C. The nodakenin content in the SRE was analyzed by HPLC using the protocol of Seo and Shin with slight modifications (23). The gradient eluted consisted of water with 0.1% trifluoroacetic acid (A) and acetonitrile with 0.1% trifluoroacetic acid (B). The mobile phase was used under binary linear gradient conditions as follows: 0–15 min, 10–60% B; 15–20 min, 60–100% B; 20–23 min. 100% B; 23–25 min, 100–10% B; 25–30 min, 10% B. The flow rate was 1.0 mL/min, and the injection volume was 10 μL. Peaks were identified by comparing their retention times and UV-vis spectra with the nodakenin reference; data from three independent experiments were quantified using the corresponding curve of nodakenin.

Handling and care of experimental animals

5-Week-old male and female Crl:CD (SD) rats were obtained from Orient Bio Inc (Seongnam, Korea). Female rats were nulliparous and non-pregnant. Male ICR mice were obtained from Raonbio Co., Ltd (Yongin, Korea). The animals were housed individually in suspended, stainless-steel cages in an animal room at 23.1 ± 0.6°C, relative humidity of 57.5 ± 3.6%, and air ventilation of 10–15 times/hr (all-fresh ventilation) under illumination for a 12 hr day (from 8 am to 8 pm). The rats and mice had free access to commercial food pellets and clean drinking water. Instead of 2,000 mg/kg/day, which is the generally accepted maximal dose in toxicological evaluations, the maximal dose of SRE was set at 5,000 mg/kg/day to strengthen the confidence of the toxicological evaluation. The SD rats were used in the single-dose, 4-week repeated-dose, and the 13-week subchronic oral toxicity tests, whereas the ICR mice were used in the PO-mediated gout model. Clinical signs and general appearance were observed once a week, and body weight and food consumption were also measured once a week. There was no treatment-related mortality during the experiment at any given dose. Blood samples were collected from the abdominal aorta under light ether anesthesia. Finally, a necropsy was performed at the end of the experiment.

Oral single-dose toxicity test

In the single-dose toxicity test, male and female SD rats were administered either vehicle or 5,000 mg SRE/kg via the oral gavage method (each group, n = 5). Each animal was observed for mortality clinical signs and behavioral changes such as salivation, lethargy, diarrhea, tremors, and convulsions after the first half-hour, every hr for six hr, and once daily for 13 days. Individual animal weights were recorded at the acquisition, grouping, immediately before administration, once a week during the study, and immediately before necropsy. The ocular fundus of all males and females was examined shortly before the scheduled termination using an indirect binocular ophthalmoscope (IO-H, Neitz Instruments Co., Japan). On day 13, surviving animals were anesthetized with CO₂ inhalation, and the abdominal aorta and vena cava were severed. All animals were subjected to terminal necropsy at the end of the experiment, and vital organs were carefully observed macroscopically.

4-Week repeated-dose toxicity test

The 4-week repeated-dose toxicity (DRF) studies were conducted at doses of 0, 500, 1,000, 2,500, and 5,000 mg SRE/kg/day via the oral gavage method. 5-Week-old-old male and female specific pathogen-free SD rats were acclimated for 5 days before the administration. When the rats were 6-weeks old, they were exposed to SRE (0, 500, 1,000, 2,500, or 5,000 mg/kg/day) by daily gavage for 28 days (each group, n = 10). Individual dosing volumes were calculated based on 10 mL/kg of body weight as a dose volume. Control SD rats of both sexes (each sex, n = 10) received the vehicle only at the same time and until the end of the experiment.

13-Week subchronic toxicity test

Based on the 4-week DRF results, subchronic 13-week DRF studies of SRE were conducted with doses of 500, 1,000, 2,000, and 5,000 mg SRE/kg, with doses administered once daily by oral gavage in a dose volume of 10 mL/kg. 5-Week-old male and female specific pathogen-free SD rats were acclimated for 5 days before administration. During the study, body weight and food consumption rates were measured once a week. Cage site examinations were conducted daily, and mortality and clinical signs were recorded weekly.

Five groups of 10 males and 10 females were administered SRE once daily by oral gavage at doses of 0 (vehicle control), 500, 1,000, 2,000, or 5,000 mg/kg/day in a dose volume of 10 mL/kg for 13 weeks. Clinical signs and general appearances were observed once a week, and body weight and food consumption were measured once a week. A necropsy was performed at the end of the experiment.

Biochemical analysis

At the end of the experiment, blood was collected in plain tubes (for biochemistry) and EDTA-containing tubes (for complete blood count analysis) from the abdominal aorta and used for hematology, plasma coagulation, and blood biochemical tests. Urine samples were collected using metabolic cages for 24 hr. Through a necropsy, organ weights (testes, ovaries, uterus, prostate, spleen, liver, adrenal glands, kidneys, heart, lung, brain, pituitary, and thymus) were measured, and histopathological evaluations were conducted. Biochemical analysis and complete blood count from blood samples were performed using a Hitachi 7180 (Hitachi, Tokyo, Japan) and an automatic multichannel blood cell counter (ADVIA 2120, SIEMENS, Berlin, Germany), respectively.

Induction of hyperuricemia in mice and experimental protocol

The maximal treatment dose of SRE in mice was set at 500 mg/kg, which showed a remarkable reduction in serum uric acid in male rats. Potassium oxonate was employed to induce gout mediated by the inhibition of uricase, according to a previous report (18). Here, we used male mice to investigate antihyperuricemia, because endogenous reproductive hormones during the menstrual cycle largely affect uric acid levels (24). Male mice were randomly assigned to one of seven groups (n = 7): (1) vehicle, (2) PO (250 mg/kg), (3) PO + 125 mg SRE/kg, (4) PO + 250 mg SRE/kg, (5) PO + 500 mg SRE/ kg, (6) PO + allopurinol, and (7) PO + benzbromarone. Briefly, mice were intraperitoneally (i.p.) injected with 0.9% NaCl in PBS containing PO (250 mg/kg) 2 hr before SRE, and allopurinol (5 mg/kg body weight), benzbromarone (10 mg/kg body weight), or the vehicle was orally administered for 8 days. A necropsy was performed at the end of the experiment. Through necropsy, organ weights (liver, thymus, spleen, and kidneys) were measured, and histopathological evaluations were conducted. Blood samples were collected through the abdominal aorta. Blood samples were allowed to clot at room temperature (25 ± 2°C) for 30 min. Serum was separated via centrifuge at 3,500 ×g for 10 min at 4°C, and creatinine level and xanthine oxidase activity in serum were measured using a commercial assay kit (25). Urine samples were collected using metabolic cages for 24 hr, and then UA level was determined using a UA assay kit (MyBioSource, SA, USA).

Histology

After euthanasia, kidney tissue was removed, fixed in 10% buffered formalin, and subjected to a routine histological process for paraffin embedding and light microscopic examination. Sections (6-μm thick) were stained with hematoxylin and eosin (H.E.). A blinded histological analysis was performed by a trained histologist.

Statistical analysis

Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using SPSS version 12.0 (IBM, Chicago, IL, USA). The differences between the vehicle control and the treated groups were analyzed through parametric or non-parametric multiple comparison procedures after one-way analysis of variance (ANOVA). If the variance was similar, Duncan’s test was used, while if the variance was not similar, Dunnett’s t-test was applied. Differences were determined to be statistically significant if p < 0.05.

Phylogenetic confirmation of Saposhnikoviae Radix

The ambiguity of the origins of herbs makes them difficult to be utilized for clinical and industrial purposes (2). To confirm the originality of Saposhnikoviae Radix, a phylogenetic analysis based on the ITS alignment and genetic analysis of the ITS region was conducted. In the ITS2 regions, a total of 20 single-nucleotide polymorphisms were detected, and Saposhnikoviae Radix, Peucedani Radix, and Glehniae Radix were divided into different groups on a phylogenetic tree. Among the nine commercially available specimens, three specimens coincided 100% with Saposhnikovia divaricate (Turcz.), while others showed 95% (n = 3) or 99% (n = 3) coincidence (Fig. 1).

Determination of the stability of the SRE

The chemical stability of the extract is an important factor for the application for medicinal purposes (26) because low stability and/or degradation of the active compound can cause a reduction in its therapeutic efficacy. In addition, there is a possibility that an unintended transition to unrecognized derivatives could cause late toxicity. Thus, the stability of SRE was determined based on the changes in the content of nodakenin (Fig. 2), which is an active coumarin found in SRE (9), at 4°C and ambient room temperature for up to 12 months. As shown in Fig. 2, nodakenin in SRE stored at 4°C was highly preserved for up to 12 months, but SRE stored at ambient temperature Evaluating Toxicity of Saposhnikovia Radix Extract 375 slightly degraded over time. Thus, SRE appears to be stable when stored at 4°C for up to 12 months without loss of its active component.

Acute toxicity of SRE

For determining the acute toxicity, a single-dose toxicity test of SRE was conducted at 5,000 mg/kg in male and female rats (each n = 5). No mortality and no notable clinical signs were observed in either the vehicle control or the 5,000 mg SRE/kg group, including abnormal gait, dehydration, high or low posture, clear oral or nasal discharge, wet or stained fur, salivation, ataxia, or lethargy. There was no toxicologically significant difference in body weight changes (data not shown). At the necropsy, there were no gross findings in SRE-treated male or female rats compared to the control group. Based on these results, the approximate lethal dose (ALD) of SRE is greater than 5,000 mg/kg body weight in rats.

Subchronic toxicity of SRE based on the 4-week repeated DRF study

During the 4-week repeated oral administration of SRE at 0, 500, 1,000, 2,500, or 5,000 mg/kg/day (each group, n = 10), there were no significant differences in body weight between the control and SRE-treated groups (data not shown). No adverse effects of SRE administration on mean food consumption were observed at any dose in males or females. No clinical signs of toxicity or mortality related to SRE administration were observed in the rats during the 4-week DRF period at any given dose. With respect to the ophthalmoscopy results, no abnormalities were detected at any dose in males or females. The weight of the lungs of the female rats at 500 and 1,000 mg SRE/kg/day and the thymus in female rats at 1,000 mg SRE/kg/day were higher than that of the control group, but the difference was slight and was not observed in any other groups. Thus, these results are considered a result of biological variation. Regarding microscopic findings, cornified inflammatory cells were observed in adjacent adhesion sites of the spleen and adipose tissue in the female group of rats consuming 500 mg SRE/kg/ day. However, these findings might be associated with a single, accidental phenomenon. Infiltration of inflammatory cells and bronchial alveoli were observed in the lungs of the SRE-administrated groups to a mild or minimal degree. Slight hair loss was observed in 500 (1/10 males), 2,500 (1/10 males), and 5,000 (1/10 females) mg/kg/day SRE-administrated rats, but this effect of SRE at the given doses might be considered a momentary occurrence because of its sporadicity. No other differences were observed between the control and SRE-administrated groups. Significant hematological differences were not identified in SRE-administrated groups, except for a slight increase in white blood cell (WBC) count and neutrophil percentage in males receiving 2,500 mg SRE/kg/day, percent of large unstained cells (LUP) in females receiving 2,500 mg SRE/ kg/day, percent of basophils (BAP) in females receiving 5,000 mg SRE/kg/day, hematocrit of males receiving 2,500 mg SRE/kg/day, and both RDW and reticulocyte percentage in females receiving 500 mg SRE/kg/day compared to the control group (p < 0.05). In a biochemical analysis in serum, there were no significant changes, except a decrease in the sodium (Na) concentration in males consuming 1,250, 2,500, and 5,000 mg SRE/kg/day (p < 0.01) and total bilirubin in females consuming 5,000 mg SRE/kg/ day (p < 0.05). Collectively, all of these results suggest that SRE up to 5,000 mg/kg/day does not cause toxicity in either male or female rats.

Evaluating 13-week repeated toxicity of SRE

Saposhnikoviae Radix (the root of Saposhnikovia divaricate) is an important traditional medicinal plant used in East Asia, including China and Japan. However, systemic toxicological evaluations have not been reported until now. In this experiment, acute, 4-week DRF, and 13-week subchronic toxicity evaluations of SRE were conducted on male and female rats. There were no significant toxicological outcomes of up to 5,000 mg SRE/kg/day. Therefore, the oral SRE supplementation was safe up to 5,000 mg SRE/kg/day, and these data provide a basic toxicological assessment for future identification and development of SRE and its components as therapeutic agents. The SRE stored at 4°C was stable for up to one year based on the changes in nodakenin content. In the PO-induced mouse gout model, SRE supplementation suppressed hyperuricemia by inhibiting XO activity and thereby contributed to the blockage of UA-mediated kidney damage.

The 13-week toxicity study administering SRE to rats resulted in zero deaths. No behavioral alterations were recorded during the first half hour or at check-in points every six hours after the administration of SRE. Hence, the LD₅₀ of SRE is thought to be greater than 5,000 mg/ kg, and SRE can be considered non-toxic up to that dose. In 13-week subchronic toxicological evaluations of SRE up to 5,000 mg/kg/day, including changes in body weight (Table 1), food consumption rate (Table 2), urinalysis (Table 3), serum biochemistry (Table 4), hematology (Table 5), weight of organs (Table 6), and histopathology (Table 7), no meaningful toxicological outcomes were observed in either male or female SD rats (each group, n = 10). In conjunction with no differences in food consumption rate, there were no significant changes in body weight gain (each group/sex, n = 10). A significant increase in total cholesterol and TG levels (Table 4) was observed at 500 and 1,000 mg of SRE in male rats without differences in food consumption rate (Table 2). However, this observation might be a result of random biological variation because these results were not found at the same dose in female rats and were also not found at higher doses of SRE in rats of either sex. To the best of our knowledge, there is no report indicating that SRE could cause increases in fat deposition. A decrease in total protein observed at 1,000 mg SRE/kg/day in male rats also appeared to be a result of random biological variation. In the urinalysis, no meaningful toxicological outcomes were observed at any given dose of SRE. Furthermore, no differences were seen in the weight of the spleen and thymus or blood composition, including red blood cells, hemoglobin, WBCs, platelets, among others. When evaluating changes in organ weight, there were no significant differences at any given dose of SRE except in the spleen and thymus; however, these changes seem to be normal variations because a dose-dependent outcome was not observed and the changes were only seen in female rats. Moreover, pathological findings were not observed in the spleen or thymus (Table 7). In the pathological evaluation of the tissues, there were no meaningful outcomes suggesting toxicity of SRE (Table 7). Collectively, the SRE administration of up to 5000 mg/kg was safe. Considering that SRE is a mixture of various compounds present in Saposhnikoviae Radix, isolated individual active compounds from SRE and mixtures thereof are likely safe in doses up to the equivalent of that in 5,000 mg SRE. It should be noted that the toxicological outcomes of SRE presented in this experiment are based on the conditions of a normal chow diet with SRE supplementation; thus, toxicological side effects of SRE cannot be completely excluded due to the absence of evidence regarding interactions with classical synthetic drugs and/or foods such as grapefruit juice, which can modify the absorption, distribution, metabolism, and/or excretion processes (32).

Gout is a common form of inflammatory arthritis caused by excessive deposition of monosodium urate, resulting in pain, damage, and deformity of joints. Gout incidence (0.3–6 per 1000 person-years) and prevalence (1–10%) have been increasing (33) and are becoming important health burdens worldwide. Chronic hyperuricemia is the main precursor of gout; thus, inhibition of XO overactivation is a promising therapeutic option to limit the harmful effects of excess UA (27). Traditionally, Saposhnikoviae Radix is called “Bang Fung” in Korea and “Fang-Feng” in China, which means “to prevent gout.” However, the scientific evaluation of SRE against gout has not been well established. The SRE supplementation at 500 and 1,000 mg/kg/day for 13 weeks significantly lowered serum UA in male rats but not female rats (Table 4). There were no significant toxicological manifestations in the subchronic 13-week repeated-dose toxicity of SRE. Therefore, the antihyperuricemic potential of SRE was investigated in this study on PO-insulted mice model. Hyperuricemia is an underlying condition of gout, and long-term treatment of gout almost always involves the therapeutic lowering of serum urate level through the use of XO inhibitors (e.g., febuxostat), enhancing the degradation and inhibition of urate reuptake in the kidney (34). Furthermore, anti-inflammatory strategies targeting interleukin-1 beta (IL-1β) have been explored recently (34). However, safety concerns about medications treating acute and chronic gout are still present (35). In addition to toxicological evaluations of SRE, the present study provides evidence, using a PO-mediated experimental mice model, for the therapeutic potential of SRE against hyperuricemia and gout. Potassium oxonate blocks the effects of hepatic uricase that produce hyperuricemia in mice (18) and thus was used as a model system for investigating nephropathy and other toxicity evaluations connected with excess UA (19). The supplementation of SRE suppressed the production of UA in serum and urine (Fig. 3A). This reduction of UA by SRE supplementation was associated with its inhibitory action on XO (Fig. 3B). High levels of serum UA can cause kidney disease and secondary hypertension (36). Allopurinol is a specific inhibitor of xanthine oxidase, which is the key enzyme for the metabolism of purine nucleotides to uric acid. Serum creatinine levels reflect the malfunction of the kidney and are not directly affected by xanthine oxidase activity. Thus, it seems that the serum creatinine levels were not significantly reduced by allopurinol despite xanthine oxidase inhibition by allopurinol (Fig. 3B). This result may indicate that SRE supplementation may exhibit dual effects: suppression of uric acid production and protection against secondary renal damage caused by excessive uric acid.

It should be mentioned that oxonic acid is not an ideal uricase inhibitor because oxonic acid and its salts are foreign substances that could interfere with other metabolic systems (19). In general, the reduction of body or organ weight indicates that a certain substance has toxicity or is metabolized into another toxic substance. It is unclear whether a significant decrease in the liver weight of PO-treated mice was associated with its interference with the metabolic system(s) and/or its toxic effects in the liver. However, the supplementation of SRE was able to attenuate the weight loss of the liver (Table 8).

Collectively, SRE did not display acute, 4-week DRF, and 13-week subchronic toxicity of up to 5,000 mg/kg based on toxicological parameters. The SRE showed antihyperuricemic effects via the inhibition of XO activity, suppressing PO-induced pathological changes including nuclear condensation and hyaline cast formation in the kidney. To the best of our knowledge, this is the first toxicological and safety evaluation of SRE, and the results support its therapeutic potential against hyperuricemia in rodents in accordance with its traditional use.

The SRE was safe up to 5,000 mg/kg/day based on NOAEL found in acute and 13-week subchronic toxicological evaluations. Furthermore, SRE showed antihyperuricemic effects and lowered the excessive level of uric acid, which is associated with gout and kidney failure.

This work was supported by a grant from the Ministry of Food and Drug Safety, South Korea, in 2016 (15182MFDS452).